- Babe, babe, babe ohhh


canon eos 550D + canon EF 50mm f/1.8 II

Tagga bilarna i bakgrunden på första bilden.. Nat:$. 
Anyway.. Sitter här och lyssnar på *trummvirrvel* JUSTIN BIEBER - BABY! Haha jag vet.. Men har haft den på hjärnan idag så nu när jag kom hem efter träningen satt jag på den:]. Hihi, jag tycker faktist att musikvideon är ganska gullig:$. Plus att han är typ snygg.. 

Ehhmm.. Varför vart dehär ett inlägg där jag typ älskar justin bieber, men hatar han annars:o?

- LinnennnnnnN


Linne Monki 150:-


Linne Gina tricot 49:- rea


Linne Gina tricot 99:-


Nya brillz! Gina tricot 49:-

Detta var sakerna som inhandlades i umeå! Det enda som saknades på listan var en ny bikini-överdel och en bandeau. Men det får jag väl helt enkelt köpa här i skell dådå..:$ Det vita linner har jag också även tänkt ha på mig på skolavslutningen. Nepp, det blir ingen klänning för mig och ja, jag hatar klänningar..

Idag for jag ju till umeå igen. Spelade match mot umeå södra och vann med 0-3! Dagens minus var väl då att det regnade och var just och pass plussglader..:( Åsså fick man inte mycket att göra i mål så dår stog man bara där som ett fån och frös, mys! Haha, nä skoja bara men ska käka något litet sen blir det att se några avsnitt av glee. Puss♥

- Nightflight resan 2011





Kl 8 imorse for alla som jobbade på night flight till Umeå!
Där vi bland annat körde lazer doom, shoppa tills fötterna blödde bokstavligt, käkade på McDonalds + på någon resturang med tacobuffé och såg på bio - baksmällan II. Och tillsammans med underbara vänner vart även dagen awesome:D.

Nu är klockan för mycket.. Ska till Umeå igen! Hahah.. Tagga gå upp kl 7 igen imorn, nat..
Btw, blider på plaggen jag köpte visar jag imorgon + nå fler bilder från dagen. Godnatt

- Mi madre


Igår när jag var hos mormor hittade jag ett gamalt foto på mamma. På bilden är hon där runt 17 års ålder haha.. Kolla in frillan;). Iallafall så vet jag att jag är överdrivet lik min mamma.. Det är många som påpekar det, dagligen.. Men va tycker ni? Lik eller olik;)?

- Vitt och rosa


canon eos 550D + canon EF 50mm f/1,8 II

Wiihoo, sista skoldagen = fredag:D! Ikväll ska jag ta det lungt med familjen och vila mig inför imorgon. För imorn ska jag till ume och vara där hela dagen tillsammans med alla andra som jobbade på night flight:D:D! Kommer blir sjukt kul säkert och är taggar till 10000. Vi ska bl.a shoppa, chilla, lazerdoom, bio och äta buffé. 
TAGGATAGGATAGGATAGGATAGGATAGGATAGGA osvsov.. Haha

- Firande åt mormor och tidig morsdag


canon eos 550D + canon EF 50mm f/1.8 II

Tog en paus från min filmresension som ska vara inlämnad imorgon och for till mormor tillsammans med mamma och kevin. Vi hade födelsedagsfirande i efterskott till henne. Det var sjuuuukt längesen jag var hos henne:O! Vi hade jätte kul, kolla gamla foton och pratade om allt möjligt!

- Våravslutning


Ikväll cyklade jag och Emma iväg till söder
. Det var riktigt mysigt! fika försäljning och en massa sång. Och ett stort + till att solen sken! Nu ska jag varva ner med att se grey's anatomy;).

- TÄVLING


Jag har aldrig tävlingar..
Men nu hade jag faktist tänkt att ha en:)!


Regler för att vara med:
Skriv i detta inlägg att du är med, + en motivering till varför du vill vara med

Enkla regler, så nu ser ni till att vara med;D!
tävlingen avslutas tisdag 27/5

- turkost



t-shirt
H&M | Håliga jeans cubus | convers skorett

Hallådär kött och blåbär! När jag kom hem från sklan idag tog jag mig ann ett löppass. Sen har jag suttit med päronen och planerat sommaren.. I vilket fall blir det nog bra, vad vi än bestäm:D! Snart ska jag hoppa in i duschen och sen ska jag på "våravslutning" på söder.

- Summer 69'



Modell: Jessica Lindh Foto: Jag
Canon eos 550D + canon EF 50mm f/1.8 II


Har just varit och tränat. Nu ska resten av kvällen spenderas med tv serier och gruvning inför morgondagen = skola.. PussN

- The end


canon eos 550D + canon EF 50mm f/1,8 II

Helgen har varit en underbar helg! Har gjort en massa, träffat en massa, skrattat och ja.. Allt de där:D. Idag ska jag bara ta det lungt = käka nudlar och se tv serier♥. Och sen för att det inte ska bli sämre avslutas dagen med fotbollsträning;).

- Klockren

Tumblr_lle0lbsdzx1qac52bo1_500_large

- Tävling! (igen)


Är med i en liten tävling igen. Den här gången hos http://beattriicee.blogg.se där man kan vinna ett valfritt kamerasmycke från http://www.beccadesign.se/tag-kamera.html

Själv har jag valt detta smycke och färgen är svart. 
Motivering: Jag älskar att fota, det är en av mina bästa hobbysar. Och ifall jag skulle vinna denna ascoola ring så skulle jag bevisa för alla att fota är något jag brinner för!

- Not this time either


Igår kväll så for jag över till clara där jag och hon tänkte se klart harry potter filmerna..
Albin och edward joina också. Men det vart inte mycket till film:$. Först såg vi typ en tredjedel, sen gick vi ut och spela fotboll efter det tog clara ut gitarren så julias spela lite. Sen efter ett långt tag tog vi oss ann och såg klart en film(6:an) :]. Efter det for edward och albin sen helt plötsligt satt vi på baksällan(?). Hahah och efter de däcka vi:]. 

Och nu ösregnar det ute.. Och jag ska ha träning om en timma.. kul:(. 


- Detalis


canon eos 550D + canon EF 50mm f/1,8 II


Lite "detaljer" jag tog igår. Gillar andra bilden starkt:$.
Idag ska jag träna, sen blir det chilla innan jag drar iväg till clara. Kom ni ihåg när jag hade "harry potter maraton" ? Iallafall så såg vi inte klart filmerna, så nu ska vi fan i mig ta och se dom klart;).


- Beautiful lady


Foto: Jag Modell: Jessica Lindh
Utrustning: Canon eos 550D + canon EF 50mm f/1,8 II


Första bilden jag hade tänkt lägga upp för idag. Älskar den, she's sooo hot.. it's burning!

- Indian popcorn


(bilderna från idag kommer upp senare på bloggen, men här har ni några gruppbilder:D)


Idag har jag varit med emma, malin och jessica! Jessica needed some new pic till sin header, så jag ställde mer än gärna upp på att vara "fotograf" haha:]. Hade riktigt kul med mina småbruttor.
Ikväll blir det film och mys med lillebrosan:D. Bara ta det lungt, haha det behövs.


- Månbarn och annat bus


Har just kommit hem från en helcrazy kväll med Jessica och Malin!
Vi har tjockat godis, varit ute på mindre äventyr och fått mig ett gott skratt på köpet. Snart ska jag ta och sussa för imorgon blir det andra äventyr som väntar!

Och för er som tar dehär med "världengårunderimorgonsaken" på allvar, så säger jag farväl;).

- Solbränna


canon eos 550D + canon EF 50mm f/1,8 II

Orken i att skriva om något intressant har blivit ointressant de senaste dagarna, sorry. Men iallafall så är det *trummvirrvel* FREDAG! Och som ja och emma gjorde påväg hem från coop. Yes, en helg att lata, inga prov att plugga till eller något!  Riktigt skönt. Snart är verkligen sommarn här:D!

I helgen ska jag göra en massa roligt, Men de får ni inte veta än. Och ett mega + till att vi har extra lång helg! Både måndag och tisdag är vi lediga, wiiho! Men nu ska jag sätta mig och se på glee. Och jag ni hör rätt.. Jag har blivit besatt av yttligare en tv-serie:o.

- I'll go back


Alla bilder fotade med kompaktkamera exilim H10

Saknar turkiet. Nu är det ca ett år sen vi var där.. Minns det som igår haha;). Men ha en bra tisdag nu allihopa!

- Rosa


tryck F5 ifall de e knasigt. 

Idag har jag varit hemma från skolan så då har jag haft tid till att göra klart min design. Vart inte hundra nöjd menmen, ska fixa lite till på den me var bara tvungen att få bort den andra. Usch så ful den va..

- Ladda upp med filmer


Nu har jag laddat upp med serier och filmer.. Nu ska denna jävla feber bort.


När jag vill vara i skolan som mest blir jag sjuk, härligt. Haha nää, men jag undrar varför jag sitter vid datorn just i detta ögonblick, för ju bara mer ont i huvudet..? haah what ever. Denna dag har iallafall inte varit min lyckodag, men det kommer bättre dagar såklart. Men nu ska jag ta och se tv med mamma eller något liknande.

- Marabou kakor



Mmmmm.. Marabou kakor! For och handla och idag var min pappa på ett bra köpaonödigasakerhumör! Och eftersom det är vm-final så köpte vi lite onyttiga saker bla dessa kakor! Sjukt goda är dom ett måste att testa:D. 

Idag har det varit en typisk lat-dag för fanny;). Jag har till och med tacka nej att vara med folk.. Hur tråkig är inte jag?! Haha, iallafall så tror jag har dragit på mig en rejäl förkyldning, jippie.. 

- En dag i Umeå


canon eos 550D canon Ef 50mm f/1,8 II


Hola amigos! kl 11 idag for jag tillsammans med f17län och spela match i umeå mot röbäck. Vi förlorade, men minnen därifrån kommer jag garanterat att ha! Kom hem där runt halv8 och då drog jag mitt lata arsle till jaanas där resten av kvällen spenderades. Nu ska jag sätta på någon film, och SOVA ut!

- Milkshaki-shake!




har just druckit upp min päron&äppel-milkshake!
Grymt gott var det:D. Snart ska jag och kevin tjocka godis och se trassel;). Har ju inte sätt den en så jag måste ju ta och se den nu.. Ha en bra fredag nu♥

- BehindTheCamera


canon eos 550D + canon Ef 50mm f/1,8 II

Är med och tävlar hos http://behindthecamera.webblogg.se om ett halvtonat filter hos http://www.tvspelsweb.se. Själv har jag valt detta halvtonade filter.

Varför jag valde denna bild?
Somrig, fin, motljus, skor. Allt som man älskar är med i bilden! Jag gillar även redigeringen på den med.

- Helgen


Sådärja. Nu ska jag gå och duscha, luktar skunk..

- Före&efter


Har klippt och även slingat håret ljusare. Hiss diss?
Själv tycker jag det ser lite smutsigt ut in real life. Det ser lite solblekt-brunt, fast vart inte helt toknöjd. 

Snart ska jag göra mat till jag och brosan, sen drar jag iväg på träning. Sen blir det bara plugg, plugg och mer plugg.. Puss!

- Mössa


Mhhmm.. Undra vad fanny ska göra ikväll;)?
Resultat kommer imorgon!

- Grönögd

Jag hatar mina ögon, i alla dess vinklar.. För det första är dom små, jag får dock också höra de ett x-antal gånger. Men dom är även gröna, vilket jag inte förstår.. För nästan alla blondfödda har ju blåa?! Nae, Jag gillar inte mina ögon. Och det som gör helheten är att jag skrattar så blir dom bokstavligt talat som sträck på en träckgubbe! Haha, fast de ser lite kul ut:].

Men efter jag tog denna bild är jag faktist stolt över dom. Jag mena, utan mina gröna små ögon skulle jag ju inte vara jag;). Eller, så kanske det bara är i dehär ljuset som gör dom speciella, vad vet jag..

- Björklöv


canon eos 550d + canon EF 50mm f/1,8 II
Åhh.. Mysigt värre när löven på björkarna börjar slå ut..:]

Kom just hem från en grymt jobbig träning. Ska snart hoppa in i duschen och sedan gå med doris ut en sväng och efter det drar jag på söder:D!

- Fotboll är så underbaaart!


canon eos 550d + canon EF-S 18-135mm f/3,5-5,6 IS
ph 1&2 har jessica tagit


Det var nog inte bara för mig det var fel för när man skulle publicera inlägg igår.. Fick nästan hybris eftersom jag tyckte att jag var så duktig som kunde uppdatera igår. Men icke sa nicke dede.. Iallafall så spelade jag match igår med f17län, och jessica var där och kollade på och tog kort med min kamera osv. Vi vann btw med 5-1!
Sen hade juliah match efter oss så jag stannade kvar tillsammans med julias och pär busade bara på sådär lagomt.

- Dagisbarn


..Såhär kan man råka se ut när man har varit och praoa första dagen på ett dagis!


..Och då förtjänar man sig en glass på kiosken efter sitt hårda arbete med att hålla ett gott humör. 
Ohhskit.. Snart blir det träning(U)

- De här är värt att dö för


canon eos 550d + canon EF 50mm f/1,8 II

Med detta inlägg säger jag godnatt.

- Harrypotter maraton




Canon eos 550d + canon EF 50mm f/1,8 II

Hejsan alla glada figurer! Igår kväll drog jag och julias över till clara och där var även juliah. Vi hade bestämt att vi skulle se alla harrypotter filmerna men såg bara 3,4&5..:$ Lucas och Edward kom också över en liten stund. Det var helmysigt! Och pigg som jag är väckte jag dom kl 9 imorse, gissa om dom vart glada;)?
Har kommit hem från match.. Förlust tyvärr mot mariehem. Menmen, de är bara att ta i med nya tag! Imorgon väntas också match och då ska jag minsann spela! Jag är värsta nervös...

- why so sad


canon eos 550d + canon EF 50 f/1.8 II

Nämen ni.. Egentligen ska jag hoppa in i duschen nu. På skolan badade vi sen for jag hem och bytte om till träningskläder och spela liiiiite fotboll. En blandning mellan klor och svett, mmmmaraboou.

Imorgon är det inte mindre än FREDAG! Åhh, vad tiden går snabbt.. Och nästa vecka kommer vara chill, vi har prao hela veckan fast.. Lungt kommer det inte vara, kommer att brottas med småbarn på mitt gamla dagis;). 

- Lonely but forgiven



canon eos 550d + canon EF 50mm f/1,8 II

Stackars dig, du är fast här med mig.-

- Förlust


canon eos 550d + canon EF-S 18-135mm f/3,5-5,6 IS
(bild tagen igår)

Kom hem ca 1 inatt efter att ha varit och spelat fotboll i vännäs. Seriestart, men dock gick det inte så bra för oss. Men resan dit och hem är alltid underhållande:)! Var ju även på praso under dagen och kollade på linje inför gymnasiet även om det är två år kvar dit.. Kollade in estetik/media, verkade hyfsat intressant.
Läxor i massor, och annat skoj. Men ett inlägg ska man alltid hinna med hehe.. Ikväll blir det vila och plugg sen såklart grey's anatomy:D.

- fast bakgrund

body {
background: #d7c0aa url(https://cdn1.cdnme.se/cdn/6-1/2084063/images/2011/bakground2_140211756.png) no-repeat;
background-repeat: no-repeat;
background-position: ;
background-attachment: fixed;
margin:0;
padding:0px 0 14px;
text-align:center;
color:#000000;
}*


Fick en fråga på bloggen för drygt en vecka sen att jag skulle visa hur man gör en fast bakgrund. Visar i samma veva hur man lägger upp osv. 

Längst upp i din stilmall så har du en kod där du lägger in din bakgrund eller bestämmer färg. 
Såhär ser den ut om du har orange city

body {
background: #F5DFB1 url(http://dinbil.se/);
margin:0;
padding:0px 0 14px;
text-align:center;
color:#000000;
}


Ta bort hela den koden och ersätt den hära

body {
background: #d7c0aa url(http://dinblid.se/);
background-repeat: no-repeat;
background-position: ;
background-attachment: fixed;
margin:0;
padding:0px 0 14px;
text-align:center;
color: #000000;
}

background-repeat betyder ifall du vill upprepa den eller inte. Om inte så skriver du no-repeat och om du vill ha att den upprepar bara åt sidan så skriver du x-repeat.
background-position betyder vars du vill ha den right, center eller left

Tyvärr vet jag inte vad background-attachment betyder, va det menas med de. Så låt den bara vara. 
(antar att det är ifall man vill ha fast or not)

Men så är det ju samma gamla visa med alla koder och stuff. Man måste testa sig fram ifall de inte passar dig, testa något nytt!


- Back N white




Testade redigera lite svartvita bilder. Vilken tyckte ni vart bäst?

Hej på er! Lite lustigt när jag nyss kollade på statistiken så var den över de normala! Då känner jag mig dock lite skamsen att inte ha uppdaterat nånting..:$ Har spelat fotboll hela dagen om det räknas som ursäkt;). Ska mysa den sista tiden nu innan jag ska sova, så ha det bra nu!

- Valborgs




canon eos 550d + canon EF f/1,8 II

En trött tjej sitter och skriver just nu. Det har varit full rulle hela dagen. Följt pappa och handlat kört lite löpning av olika slag och har lagt upp planer som sedan skulle ske på kvällen. Där runt 7 kom en massa roliga människor till min lya. Vi gick ner till älven och grilla prata, skrattat och sjungt halsen av oss. Har haft en lyckad kväll, för min del va det längesen jag hade såhär kul!

Men måste verkligen ta och sova. Match imorgon tillsammans med f17 län. Hoppas att de går bra för mig bara!

RSS 2.0